Organophosphorus compounds
![eMolecules [Bis(2-diphenylphosphino)ethyl]ether, min. 98% | 50595-38-5 | MFCD00233065 | 1g](https://assets.fishersci.com/TFS-Assets/CCG/product-images/502169008.JPG-250.jpg)
eMolecules [Bis(2-diphenylphosphino)ethyl]ether, min. 98% | 50595-38-5 | MFCD00233065 | 1g
Strem Chemicals | [Bis(2-diphenylphosphino)ethyl]ether, min. 98% | 1g | 432919892 | 15-0383 | 98.000 | 50595-38-5 | MFCD00233065 | 442.479 | C28H28OP2
If you are unable to find the chemical you are looking for, make sure you are logged into your fishersci.com account and click on the following link:
eMolecules Building Block Tool
Matrix Scientific 2-(Di-t-butylphosphino)biphenyl, 224311-51-7, MFCD01862440, 1g
Molecular Formula C20H27P, Purity 99%, Molecular Weight 298.41, Melting Point 85°
Apexbio Technology LLC LEP (116-130) (mouse) 258276-95-8 25mg
LEP 116-130 (mouse) is an amidated peptide fragment derived from mouse leptin It is designed to mimic leptin-like biological activities thereby contributing to the regulation of energy balance and appetite through hypothalamic signaling pathways LEP 116-130 (mouse) exerts its biological activity by engaging pathways associated with body weight homeostasis and food consumption Based on these pharmacological properties LEP 116-130 (mouse) holds research potential in the fields of obesity metabolism regulation and related signaling pathologies
eMolecules 551950-92-6 | Ambeed | (2S4S)-Pentane-24-diylbis(bis(35-dimethylphenyl)phosphine) | 100mg | 633659896 | A1229127 | 552.723 | C37H46P2
Ambeed | (2S4S)-Pentane-24-diylbis(bis(35-dimethylphenyl)phosphine) | 100mg | 633659896 | A1229127 | 551950-92-6 | 552.723 | C37H46P2
Sigma Aldrich Fine Chemicals Biosciences Tributyl phosphine oxide United States Pharmacopeia (USP) Reference Standard | 814-29-9 | MFCD00002082 | 25MG
Tributyl phosphine oxide United States Pharmacopeia (USP) Reference Standard | Mol Wt: 218.32 | 814-29-9 | MFCD00002082 | 25MG
![eMolecules 71042-55-2 | Ambeed | (1R4S5R6R)-56-Bis(diphenylphosphaneyl)bicyclo[2.2.1]hept-2-ene | 100mg | 595928406 | A206657 | MFCD00085365 | 462.513 | C31H28P2](https://assets.fishersci.com/TFS-Assets/CCG/product-images/502449959.PNG-250.jpg)
eMolecules 71042-55-2 | Ambeed | (1R4S5R6R)-56-Bis(diphenylphosphaneyl)bicyclo[2.2.1]hept-2-ene | 100mg | 595928406 | A206657 | MFCD00085365 | 462.513 | C31H28P2
Ambeed | (1R4S5R6R)-56-Bis(diphenylphosphaneyl)bicyclo[2.2.1]hept-2-ene | 100mg | 595928406 | A206657 | 71042-55-2 | MFCD00085365 | 462.513 | C31H28P2
Medchemexpress LLC Sodium tetradecyl sulfate (Tergitol 4) | 139-88-8 | MFCD00072416 | 99.5% | C14H29NaO4S | 100 ML
Sodium tetradecyl sulfate (Tergitol 4) is a novel scleroembolic agent and an apoptosis inducer. It is intended for research applications, specifically in the study of varicose veins and vascular malformation diseases.
- Novel scleroembolic agent
- Apoptosis inducer
- Used for research on varicose veins and vascular malformation diseases
- Induces endothelial activation and release of endothelial particles
- Inhibits proliferation and induces apoptosis in EOMA cells
Medchemexpress LLC Rna, (cuagugguccuaaacauuuc) (full-length nucleotide 2'-methoxy modification) | 98.2% | 6569.33 | 20 NMOL
Hsa-miR-203a-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature microRNAs. These inhibitors feature full-length nucleotide 2'-methoxy modification, allowing them to strongly compete with mature microRNAs. This competition prevents the complementary pairing of microRNAs and their target genes, effectively inhibiting microRNA function.
- Chemically-modified oligonucleotides
- Full-length nucleotide 2'-methoxy modification
- Inhibits microRNA function
- For research use only
- Molecular weight: 6569.33
- Purity: 98.21%
- Available in various sizes, including 20 nmol
- Recommended storage at -20°C, sealed and away from moisture
- Appearance as a white to off-white solid
![eMolecules Pharmablock / tert-butyl (2S4S)-4-hydroxypyrrolidine-2-carboxylatehydrochloride / 25mg / 716244183 / PBU9736-1 / 0.000 / 2819652-33-8 / [null] / 223.700 / C9H18ClNO3](https://assets.fishersci.com/TFS-Assets/CCG/product-images/502443059.PNG-250.jpg)
eMolecules Pharmablock / tert-butyl (2S4S)-4-hydroxypyrrolidine-2-carboxylatehydrochloride / 25mg / 716244183 / PBU9736-1 / 0.000 / 2819652-33-8 / [null] / 223.700 / C9H18ClNO3
Pharmablock / tert-butyl (2S4S)-4-hydroxypyrrolidine-2-carboxylatehydrochloride / 25mg / 716244183 / PBU9736-1 / 0.000 / 2819652-33-8 / [null] / 223.700 / C9H18ClNO3
eMolecules Di-t-butylphosphine oxide, 98% | 684-19-5 | MFCD00460156 | 1g
Strem Chemicals | Di-t-butylphosphine oxide, 98% | 1g | 321336041 | 15-1041 | 98.000 | 684-19-5 | MFCD00460156 | 162.213 | C8H19OP
If you are unable to find the chemical you are looking for, make sure you are logged into your fishersci.com account and click on the following link:
eMolecules Building Block Tool
eMolecules Tetrabutylphosphonium chloride (68-72 wt% solution in methanol) | 2304-30-5 | MFCD00011854 | 100g
Strem Chemicals | Tetrabutylphosphonium chloride (68-72 wt% solution in methanol) | 100g | 576207949 | 15-7620 | | 2304-30-5 | MFCD00011854 | 294.890 | C16H36ClP
If you are unable to find the chemical you are looking for, make sure you are logged into your fishersci.com account and click on the following link:
eMolecules Building Block Tool
eMolecules 67884-33-7 | Ambeed | (S)-Propane-12-diylbis(diphenylphosphine) | 100mg | 596330135 | A114006 | MFCD00798604 | 412.453 | C27H26P2
Ambeed | (S)-Propane-12-diylbis(diphenylphosphine) | 100mg | 596330135 | A114006 | 67884-33-7 | MFCD00798604 | 412.453 | C27H26P2